Lambda DNA from New England Biolabs

Product Specs
ItemLambda DNA
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberN3011L
Source/Expression SystemIsolated from bacteriophage lambda (cI857ind 1 Sam 7)
Molecule NameDNA
Quantity1250 µg
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
Ladder TypeLambda DNA
Size Range48.5 Kbp
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Genome sequence and characterization of a novel Pseudomonas putida phage, MiCathSci RepDecember 9, 2023James Jaryenneh, Joseph S. Schoeniger, Catherine M. MageeneyDNase I step followed by DNase inactivation and eluted in diH20. MiCath and Lambda (NEB, catalog no. N3011S) DNAs were digested with EcoRI-HF (NEB, catalog no. R3101S), BamHI-HF (NEB, catalog no. R3136S), BstXI

(2) Reentrant DNA shells tune polyphosphate condensate sizebioRxivSeptember 20, 2023Ravi Chawla, Jenna K. A. Tom, Tumara Boyd, Danielle A. Grotjahn, Donghyun Park, Ashok A. Deniz, Lisa R. Racki2017)109",30152,BLR (F- ompT hsdSB(rB-mB-)gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR)) Lambda DNA,NEB Catalog# N3011L,48502,- T4 DNA,"T4 GT7 DNA, Catalog# 318-03971, FUJIFILM Wako Chemicals USA",166000,- Table of plasmids

(3) Metal Ions Modify In Vitro DNA Damage Yields with High-LET RadiationToxicsSeptember 12, 2023Dylan J. Buglewicz, Cathy Su, Austin B. Banks, Jazmine Stenger-Smith, Suad Elmegerhi, Hirokazu Hirakawa, Akira Fujimori, Takamitsu A. KatoEngland BioLabs Inc., Ipswich, MA, USA, stock concentration of 500 ng/μL, 48,502 base pairs in length, N3011S) or 83 ng of single-strand DNA (ssDNA) of M13mp18 phage (New England BioLabs Inc, stock concentration

(4) Miniaturized Non-Contact Heating and Transmitted Light Imaging Using an Inexpensive and Modular 3D-Printed Platform for Molecular DiagnosticsSensors (Basel)September 7, 2023Alex Laman, Debayan Das, Aashish PriyeNovagen, Cat. no. 71085-3), 50 μM of the SYTO82 dye, 1 µL of target DNA λ-phage template DNA (Cat. no. N3011S, New England Biolabs) and 67.8 µL of PCR grade water (HyClone, Logan, UT, USA; Cat. no. SH30538.02).

(5) Microfluidic delivery of cutting enzymes for fragmentation of surface-adsorbed DNA moleculesPLOS ONESeptember 6, 2023Julia Budassi, NaHyun Cho, Anthony Del Valle, Jonathan Sokolovproduced in two steps. First, 200μl of a 50ng/μl solution (using Lambda DNA, New England Biolabs (NEB) N3011S), containing 1.5μl of the fluorescent dye SyBr Gold (Invitrogen, S11494, Thermo Fisher Scientific, Waltham,

(6) DNA methylation protocol for analyzing cell-free DNA in the spent culture medium of human preimplantation embryosSTAR ProtocolsJune 1, 2023Yuan Gao, Yidong Chen, Jie Qiao, Jin Huang, Lu Wenoil,Vitrolife,10029 Hyaluronidase,Sigma-Aldrich,H4272 Tris-EDTA,Sigma-Aldrich,T9285 Triton X-100,Sigma-Aldrich,T8787 1 M KCl,Sigma-Aldrich,60142 Lambda DNA,New England Biolabs,N3011S Proteinase K,Zymo,D3001-2-20 dNTP Mixture,TaKaRa,4019 "Klenow DNA polymerase (3′–5′ exo-, 50 U/μL)",TIANGEN,NG202-02 "Klenow

(7) Robust membrane protein tweezers reveal the folding speed limit of helical membrane proteinseLifeMay 30, 2023Seoyoon Kim, Daehyo Lee, W C Bhashini Wijesinghe, Duyoung Minat one end and azide or 2×biotin at the other end, were amplified by PCR from λ DNA template (NEB, N3011S). The primers were added to total 8 ml PCR mixture – 1 µM of a forward primer (ACAGAAAGCCGCAGAGCA) with

(8) A Microstrip Transmission Line Biosensor to Measure the Interaction between Microliter Aqueous Solutions and 1.0–17.0 GHz Radio FrequenciesSensors (Basel)May 30, 2023Mary Godfrey, Daniel Ewert, Ryan Striker, Benjamin Braaten(18.2 MΩ/cm @ 25 °C), Tris-EDTA Buffer, New England Biolabs lambda DNA containing 1250 µg (Product # N3011L), iodized sodium chloride, Kimtech wipes, 70% Ethanol spray, and a digital 2-Channel K-Type Thermocouple

(9) Etoposide promotes DNA loop trapping and barrier formation by topoisomerase IINature Chemical BiologyMay 1, 2023Tung T. Le, Meiling Wu, Joyce H. Lee, Neti Bhatt, James T. Inman, James M. Berger, Michelle D. Wang(Extended Data Fig. 1a). The 12.7-kb DNA was amplified from lambda DNA (New England Biolabs (NEB), N3011S) using the primers CTACCCGAGTGCGTGACAT and CCAGTCTCGTGAAGCGGTA with Phusion DNA polymerase (NEB, M0530S).

(10) Comprehensive benchmark and architectural analysis of deep learning models for nanopore sequencing basecallingGenome BiologyApril 11, 2023Marc Pagès-Gallego, Jeroen de RidderLambda phage dataset that we sequenced. The Lambda phage genome DNA material was purchased from NEB (N3011S). The sample was prepared according to the ONT Ligation KIT and sequenced with a MinION flow cell. Data

(11) Micromechanical Study of Hyperacetylated Nucleosomes Using Single Molecule Transverse Magnetic TweezersInternational Journal of Molecular SciencesMarch 24, 2023Santosh Gaire, Roberto L. Fabian, Raghabendra Adhikari, Pamela L. Tuma, Ian L. Pegg, Abhijit Sarkardiscussed in references [39,41]—see schematics in Figure 5. In brief, we start by functionalizing λ-DNA (N3011S, New England Biolabs, Ipswich, MA, USA), which involves ligating biotinylated DNA oligomers (five biotins)

(12) A trailing ribosome speeds up RNA polymerase at the expense of transcript fidelity via force and allosteryCellMarch 16, 2023Liang Meng Wee, Alexander B. Tong, Alfredo Jose Florez Florez Ariza, Cristhian Cañari-Chumpitaz, Patricia Grob, Eva Nogales, Carlos J. Bustamante367-93-1 Kanamycin sulfate,Sigma-Aldrich,Cat#60615; CAS: 70560-51-9 Lambda Phage DNA,New England Biolabs,Cat#N3011S; CAS: 91080-14-7 "Magnesium acetate tetrahydrate, (CH3COO)2Mg•4H2O",Sigma-Aldrich,Cat#M5661; CAS: 16674-78-5 "Magnesium

(13) Cell cycle-specific loading of condensin I is regulated by the N-terminal tail of its kleisin subuniteLifeDecember 13, 2022Shoji Tane, Keishi Shintomi, Kazuhisa Kinoshita, Yuko Tsubota, Makoto M Yoshida, Tomoko Nishiyama, Tatsuya Hiranoreagent,pUC19,Genbank: L9137,RRID: Addgene_50005, Recombinant DNA reagent,λDNA,New England Biolabs,N3011S, Sequence-based reagent,hCAP-H (CH) deletion-F,This paper,Forward primer,GAACGACTTCTCTACCGACTCTCCC Sequence-based

(14) Topological digestion drives time-varying rheology of entangled DNA fluidsNature CommunicationsDecember 1, 2022D. Michieletto, P. Neill, S. Weir, D. Evans, N. Crist, V. A. Martinez, R. M. Robertson-Anderson(kbp)), supplied from New England Biolabs at 0.5 mg/ml in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) buffer (N3011), which we concentrate to 1 mg/ml via ethanol precipitation. We note that this construct has been used

(15) Bloom helicase mediates formation of large single–stranded DNA loops during DNA end processingNature CommunicationsDecember 1, 2022Chaoyou Xue, Sameer J. Salunkhe, Nozomi Tomimatsu, Ajinkya S. Kawale, Youngho Kwon, Sandeep Burma, Patrick Sung, Eric C. Greenesubstrates were prepared as previously described17. For dsDNA with a 30-nt 3′-end tail, λ-DNA (NEB, Cat. No. N3011S) was annealed to a biotinylated oligo (5′-Phos-AGG TCG CCG CCC-3′BioTEG), and the second end of the

(16) Control of λ Lysogenic Escherichia coli Cells by Synthetic λ Phage Carrying cIantisenseACS Synthetic BiologyNovember 18, 2022Ho Joung Lee, Hyun Ju Kim, Sang Jun Leeh. Isolation, Propagation, and Purification of the Phage To isolate bacteriophage λ, 1 μg of λ DNA (N3011, NEB, Ipswich, MA, USA) was electroporated into E. coli MG1655. Electroporation was performed at 25

(17) Engineered helicase replaces thermocycler in DNA amplification while retaining desired PCR characteristicsNature CommunicationsOctober 23, 2022MomÄilo Gavrilov, Joshua Y. C. Yang, Roger S. Zou, Wen Ma, Chun-Ying Lee, Sonisilpa Mohapatra, Jimin Kang, Ting-Wei Liao, Sua Myong, Taekjip Ha\setlength{\oddsidemargin}{-69pt} \begin{document}$$\lambda$$\end{document}λ-DNA from NEB (catalog # N3011S) as a template and following primers generating 200 bp amplicon: 5′-CGGCTTCTGACTCTCTTTCC (forward) and 5′-

(18) High-resolution phylogenetic and population genetic analysis of microbial communities with RoC-ITSISME CommunicationsOctober 10, 2022Douglas B. Rusch, Jie Huang, Chris Hemmerich, Matthew W. HahnRoC-ITS 27 F Unique primer. The PCR was carried out with 1 μl of Lambda DNA (20 ng/μl; Catalog number: N3011S. Vendor: New England Biolabs Inc), 12.5 μl of KAPA 2X Master Mix, 1 μl of 10 μM Lambda_F_23S and the

(19) Chromatin Liquidâ€“Liquid Phase Separation (LLPS) Is Regulated by Ionic Conditions and Fiber LengthCellsOctober 6, 2022Qinming Chen, Lei Zhao, Aghil Soman, Anastasia Yu Arkhipova, Jindi Li, Hao Li, Yinglu Chen, Xiangyan Shi, Lars NordenskiÃ¶ldvia a Sephacryl S-1000 column. The lambda DNA (48,502 bp) were purchased from New England Biolabs (N3011L). 2.6. Chromatin Preparation Reconstitution of nucleosome arrays was conducted following the published

(20) Facile detection of mechanical forces across proteins in cells with STReTChCell Reports MethodsSeptember 19, 2022Brian L. Zhong, Vipul T. Vachharajani, Alexander R. DunnR3136 Biotin-PEG3-CoenzymeA,SiChem,Cat# SC-8618 SYPRO Orange,ThermoFisher,Cat# S6650 Lambda phage DNA,New England Biolabs,Cat# N3011 HaloTag Succinimidyl Ester (O4) Ligand,Promega,Cat# P6751 Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate,ThermoFisher,Cat#

Be the First to Write a Review!

Lambda DNA

Lambda DNA from New England Biolabs

Description

New England Biolabs

Citations (90)

Reviews

Lambda DNA from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map